cofactor for glutathione reductase catalytic cycle Type:58g

5 Route of synthesis of glutathione (GSH) involving three amino acids... | Download Scientific Diagram

Following SDS-PAGE separation of cell lysates, proteins were transferred to a membrane and immunoblotted with the 30109-1-AP anti-NLRP3 antibody, which was applied at a 1:6000 dilution and incubated for 1.5 h at room temperature The sequence of NLRP3-sgRNA used in this experiment was obtained from IDT with the sequence: UCUGCUCAUAACGACGAGGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU

EWG

Type:58g

Glutathione trong mỹ phẩm đóng vai trò là một chất chống oxy hóa cực tốt, giúp trung hòa các gốc tự do, ức chế sản xuất Melanin sẫm màu và cải thiện độ đàn hồi da, mang lại làn da trắng sáng, săn chắc hơn